| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048271 |
| Chromosome: | chromosome 15 |
| Location: | 232218 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801680 | (1 of 39) PTHR13078//PTHR13078:SF53 - FAMILY NOT NAMED // PROTEIN MAOC-1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAGTCACGCACCGAGCTTAAACAACGGCAAGCCCTTGTACGCGCTGA |
| Internal bar code: | TAAAGACCCGGCCCGAAGAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4258 |
| LEAP-Seq percent confirming: | 70.4225 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATGGCTGTGCAATCTTCG |
| Suggested primer 2: | GCTAGGAATGGGTGCTGGTT |