| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.048278 |
| Chromosome: | chromosome 5 |
| Location: | 787586 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245700 | ANK25 | (1 of 4) PF06985//PF12796 - Heterokaryon incompatibility protein (HET) (HET) // Ankyrin repeats (3 copies) (Ank_2); Predicted protein with ankyrin repeats | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCTGGCCTAGGGCCTTGGCCCTTGCTCGCTCAGCCTCCTCAAACTCC |
| Internal bar code: | TGGTGGCCATATTTGTCTAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5741 |
| LEAP-Seq percent confirming: | 97.9452 |
| LEAP-Seq n confirming: | 143 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 146 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCTGCTGTCAGAACTGAT |
| Suggested primer 2: | GCCTAGCTAACATGCGCCTA |