Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.048310 |
Chromosome: | chromosome 7 |
Location: | 4717237 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g345300 | UAP1 | UDP-N-acetylglucosamine-pyrophosphorylase-related protein; (1 of 1) K00972 - UDP-N-acetylglucosamine/UDP-N-acetylgalactosamine diphosphorylase (UAP1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGCCCCCATGCACCAAGCGCGGACTCACCATCGCAGGGGCTTGACAT |
Internal bar code: | GTTAGGCATAGGGAGGGCCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1754 |
LEAP-Seq percent confirming: | 51.3514 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGTCCGTCCAGCACATAG |
Suggested primer 2: | GGGCAACTTGCTTCACTTGG |