| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048315 |
| Chromosome: | chromosome 5 |
| Location: | 2485202 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239050 | SMM15 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) K00599 - methyltransferase-like protein 6 (METTL6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTGAAACGGTACTACCATCCTGGGCCCTTGCACTCCTCACCCTTGTG |
| Internal bar code: | GCTTTAACTAGAAAGGTTCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2281 |
| LEAP-Seq percent confirming: | 91.1504 |
| LEAP-Seq n confirming: | 103 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCCTGAGGTTTGTTGGTT |
| Suggested primer 2: | GCCACACATCCATCCCTTCA |