| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.048318 |
| Chromosome: | chromosome 7 |
| Location: | 6044301 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g355050 | (1 of 1) IPR003610 - Carbohydrate-binding module family 5/12 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTAGTGTGCGACGGCCCGTTTGTCACTAGAGTGAACCTGAACCTGAA |
| Internal bar code: | CCCGTGGTCATGGGTTATTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 948 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACCTAATTGCTGCGAGCG |
| Suggested primer 2: | ACTGCCCCCTAGAGTGAACT |