Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.048474 |
Chromosome: | chromosome 3 |
Location: | 4983031 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g179450 | SRR7 | (1 of 1) K09624 - protease, serine, 12 (neurotrypsin, motopsin) [EC:3.4.21.-] (PRSS12); Scavenger receptor cysteine rich (SRCR) protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCCGGTTGGCCGTGGCCTTGCTTGCCGCTCTGTCTGCCCGCTACAAC |
Internal bar code: | AGGCTAAGTAGAAGATGCGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3419 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGAATTGCTTGGGGGCTTG |
Suggested primer 2: | CATCCTGAAAGAATGCCGCG |