Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.048543 |
Chromosome: | chromosome 14 |
Location: | 609887 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611850 | (1 of 1) K17087 - transmembrane 9 superfamily member 3 (TM9SF3) | intron | |
lncRNA_TCONS_00189627 | intron | ||
lncRNA_TCONS_00191355 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACCTTGACAACAATGCGGGCCCTTCCCTTTCCAAGGAAAGAGGGCCCC |
Internal bar code: | GAAATGAGGGGTTTGTGCATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2076 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGCGTCGTACGTGTGAGA |
Suggested primer 2: | GGAGACCGCCAAGACAAAGA |