| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048554 |
| Chromosome: | chromosome 17 |
| Location: | 4268463 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729800 | ALB3B | ALBINO3-like translocon protein; (1 of 3) K03217 - YidC/Oxa1 family membrane protein insertase (yidC, spoIIIJ, OXA1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTTCCGTGCGCTCAAGGCGCGTGAGGCGGCTGCCAAGGCGGCATCCAC |
| Internal bar code: | CCAGGGTCAGAGTCGGTATAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2029 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCTGTCAGTCGCTTGTT |
| Suggested primer 2: | CCTGCCACTGCCTCAAGTTA |