| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.048587 |
| Chromosome: | chromosome 10 |
| Location: | 1340806 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427600 | KTNA1,KAT1,PF19 | Katanin catalytic subunit, 60 kDa; (1 of 2) PTHR23074:SF19 - KATANIN P60 ATPASE-CONTAINING SUBUNIT A1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTATCGACGCCCGACCAGCGCCCCATGACACATCTGCTACATCCCCATC |
| Internal bar code: | GTGTAGGCAAAACGTACAGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3054 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCAAAGCCCCATCCTCAA |
| Suggested primer 2: | TAAGTGCCTCCAGTGCCATG |