Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.048606 |
Chromosome: | chromosome 12 |
Location: | 5577831 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g531000 | AMT1H,AMT8 | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTCACGCGCATCGCCGGAACCTGCCACCGCTCAGCCTCCCGGCCCCCT |
Internal bar code: | GAGCGTTTCGCAGGCCAGTAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5124 |
LEAP-Seq percent confirming: | 98.8636 |
LEAP-Seq n confirming: | 87 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGTCAAGCACCAAACAGG |
Suggested primer 2: | ACTTGCAGCTTCCTGTGGTT |