| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048674 |
| Chromosome: | chromosome 12 |
| Location: | 7948548 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g552850 | CGL77 | (1 of 2) 2.1.2.10 - Aminomethyltransferase / Tetrahydrofolate aminomethyltransferase; Conserved in the Green Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAAGTGAATGGGTAGCCAGGTGCAGTGGCAGAGTAGACACAACACAC |
| Internal bar code: | AGATGATATGAGGGAATTTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 53.6585 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACGTGCTGAGTGGGCAT |
| Suggested primer 2: | GCAGCGAGAGGATTAGGGAC |