Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.048719 |
Chromosome: | chromosome 3 |
Location: | 3713765 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g168900 | FMO12 | Flavin-containing monooxygenase; (1 of 1) PTHR23023:SF40 - DIMETHYLANILINE MONOOXYGENASE [N-OXIDE-FORMING] 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCAACCCAGATACCCAACCCACCCGGCGGCACCTAACCACTGCAGGT |
Internal bar code: | TCATATGACGACAGAGGCGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2994 |
LEAP-Seq percent confirming: | 82.9268 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGACGACAGGTGAGACA |
Suggested primer 2: | CACTCATCGCAGCTGCAATC |