| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.048742 |
| Chromosome: | chromosome 4 |
| Location: | 1981250 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218950 | (1 of 1) IPR001841//IPR002110//IPR013083//IPR020683 - Zinc finger, RING-type // Ankyrin repeat // Zinc finger, RING/FYVE/PHD-type // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGATACAAGCTGCGCCTGTGCATATCGCTGGGCGCCATCCTCGTTTG |
| Internal bar code: | GATCATTCTTGTTTCAACACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1219 |
| LEAP-Seq percent confirming: | 51.1628 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGTAAAGCCCCGAGTGA |
| Suggested primer 2: | TGTCAGATCAACTCCGGTGC |