| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048755 |
| Chromosome: | chromosome 7 |
| Location: | 2235016 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327350 | CDPK8 | Calcium/calmodulin-dependent protein kinase; (1 of 1) K04515 - calcium/calmodulin-dependent protein kinase (CaM kinase) II (CAMK2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACAAAACCCGTGCTGCCAAGAGGGGAGTCGGCGGCAAGCCCTCCTGCTG |
| Internal bar code: | TTAGAGGCGATGCTAGGGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2655 |
| LEAP-Seq percent confirming: | 76.4706 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAATCCGTCAGCTGCGTGTT |
| Suggested primer 2: | TGAAACGGTGGTACGCGTAA |