Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.048790 |
Chromosome: | chromosome 12 |
Location: | 8628298 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g548200 | (1 of 1) PTHR21004:SF0 - PEROXISOMAL LEADER PEPTIDE-PROCESSING PROTEASE | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAATGAATGTATGTTAGGATGTCCTTAGATATCTGATGACAAACATAG |
Internal bar code: | TAGCGTGTCATCGTCGGTTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1579 |
LEAP-Seq percent confirming: | 93.1034 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACAACAACAGCGCCATCA |
Suggested primer 2: | AGGAGCAGCAGGAAATGGTC |