| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.048824 |
| Chromosome: | chromosome 2 |
| Location: | 8081892 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144350 | RJL1 | Small Rab-related GTPase; (1 of 1) K19372 - DnaJ homolog subfamily C member 27 (DNAJC27) | intron |
| Cre02.g144400 | uS12m,MRPS12 | (1 of 1) K02950 - small subunit ribosomal protein S12 (RP-S12, MRPS12, rpsL); Mitochondrial ribosomal protein S12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTAAACCAAAGCCACCACCACCAAAAGCGCTGCCACCGCGGCCCATCCG |
| Internal bar code: | GTCAAGCACTGCTGGTTCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3088 |
| LEAP-Seq percent confirming: | 98.4962 |
| LEAP-Seq n confirming: | 131 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 133 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACTGAGGAATTTGGGGCA |
| Suggested primer 2: | CCACAGAGCTCGGAGCATAG |