Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.048838 |
Chromosome: | chromosome 12 |
Location: | 7039711 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560450 | (1 of 1) IPR004089//IPR009053 - Methyl-accepting chemotaxis protein (MCP) signalling domain // Prefoldin | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTGCACCTCCGCCAGCTGCTTCGCCAGCTCATCCCGCTCCGCTGCCC |
Internal bar code: | ATAACGTTTGTAGTCAATAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4644 |
LEAP-Seq percent confirming: | 87.5 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTGCAGGTAAAGGCTGAC |
Suggested primer 2: | CTTCTGCCACAGCGTTTGC |