| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.048843 |
| Chromosome: | chromosome 1 |
| Location: | 7808156 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055050 | (1 of 1) K08597 - sentrin-specific protease 8 [EC:3.4.22.68] (SENP8, NEDP1, DEN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAGGCGCGTTTGAACACCGAAATACGGTACGGTACACGCACGCCGCT |
| Internal bar code: | TACTGGAGCGTAATTCCTAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2516 |
| LEAP-Seq percent confirming: | 90.3226 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCGCTCCAGGTACTCGAA |
| Suggested primer 2: | CGGCCTTCTTGCGTGAAAAA |