Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.048855 |
Chromosome: | chromosome 5 |
Location: | 2592870 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239750 | ARS13 | (1 of 2) IPR002591//IPR017849//IPR017850 - Type I phosphodiesterase/nucleotide pyrophosphatase/phosphate transferase // Alkaline phosphatase-like, alpha/beta/alpha // Alkaline-phosphatase-like, core domain; Arylsulfatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAAGCTGGAGGGTTGCGACACCGCGCCACACAGAGCCAGTAAGGGTAT |
Internal bar code: | CGGGGGAAGCTTGGTACCGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3528 |
LEAP-Seq percent confirming: | 86.7769 |
LEAP-Seq n confirming: | 105 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 121 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTGCAGCTGGTACGATGC |
Suggested primer 2: | GTTGTCAGGCAAGCACAAGG |