| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.048881 |
| Chromosome: | chromosome 15 |
| Location: | 5283195 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734612 | MRP2 | (1 of 18) 3.6.3.44 - Xenobiotic-transporting ATPase / Steroid-transporting ATPase; ABC transporter, multidrug resistance associated protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGATGGTGCTCATGTGCAGTGTGTCTGCATGCGGGTGGGGCGAGGCGT |
| Internal bar code: | GGCCAGGGTAACGACAGGATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2342 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTGCCATGGGAGTGTCA |
| Suggested primer 2: | ATGGTGTTGGAGATGGCCAG |