| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.048996 |
| Chromosome: | chromosome 16 |
| Location: | 5736367 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680700 | (1 of 4) 6.3.5.4 - Asparagine synthase (glutamine-hydrolyzing) / Glutamine-dependent asparagine synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTTCTGCACATGCTAGCAGTGTTTGGCCGCGAGACGGCCCACCCTCC |
| Internal bar code: | GTGCATGCCCAGTGCACCCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 904 |
| LEAP-Seq percent confirming: | 43.75 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGCGTACGAGCAGTAGG |
| Suggested primer 2: | GGATGCCACAGCCCTAAACT |