| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.049010 |
| Chromosome: | chromosome 1 |
| Location: | 516467 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g003100 | (1 of 1) IPR001623//IPR011011 - DnaJ domain // Zinc finger, FYVE/PHD-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGGCGGCTGGCTGTGTGCTGAGGCCTCTGTCAGCCGTGACTTGCATG |
| Internal bar code: | CAGGGCCTTGGGCATAAACGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1060 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCTGCAGAAGTCCAGTCC |
| Suggested primer 2: | GTAGAACCACCCGCAAGTGA |