Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.049051 |
Chromosome: | chromosome 6 |
Location: | 1751725 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g262977 | (1 of 2) PTHR14187//PTHR14187:SF5 - ALPHA KINASE/ELONGATION FACTOR 2 KINASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCGTGGTGTCATCATACGGGCAAGCAGGTTAGGTTGCAGTAATGCGGG |
Internal bar code: | GTGTACAAGGTTTGCACACCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4534 |
LEAP-Seq percent confirming: | 81.8182 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATGGGTTTGTTTCGCTGC |
Suggested primer 2: | GCGGGCTTCGTTTTATCGAC |