| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.049225 |
| Chromosome: | chromosome 11 |
| Location: | 4179861 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481400 | (1 of 1) K08864 - tousled-like kinase [EC:2.7.11.1] (TLK) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAAGAACGCGCCCACAGGCGCCGCCGCCGCCGCGCCCAACGCCAATG |
| Internal bar code: | TCAGGATTCGGGGCTAGTCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1103 |
| LEAP-Seq percent confirming: | 46.6667 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCGACACACGCTCTTTCC |
| Suggested primer 2: | CCGGTAGCTTTGAGGCTTGA |