| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.049237 |
| Chromosome: | chromosome 6 |
| Location: | 264979 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g250650 | EZY8,DRP4A,DRP4 | Similar to DRP4 (MX-like) class of Dynamin-like GTPases; (1 of 1) IPR000375//IPR001401//IPR020850//IPR022812//IPR023220//IPR027417//IPR030381 - Dynamin central domain // Dynamin, GTPase domain // GTPase effector domain, GED // Dynamin superfamily // Type IV secretion system, VirB5-domain // P-loop containing nucleoside triphosphate hydrolase // Dynamin-type guanine nucleotide-binding (G) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGATGTAGAGGACAGGTAAGGAGAGCGATACTACTAAGGCAATGGTCAG |
| Internal bar code: | TTCGAATTATAATCGATTTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2023 |
| LEAP-Seq percent confirming: | 74.359 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGCTGACCAAGTAAGCA |
| Suggested primer 2: | ACACGACGCTGTCCTTTGAT |