Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.049281 |
Chromosome: | chromosome 2 |
Location: | 3454364 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g098800 | (1 of 1) K09586 - endoplasmic reticulum protein 29 (ERP29) | 3'UTR | |
Cre02.g098850 | NTR2 | NADPH dependent thioredoxin reductase 2; (1 of 2) PTHR22912//PTHR22912:SF183 - DISULFIDE OXIDOREDUCTASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCCAGGACGTTGCAGGACACGCGGGATTGAGCGCGAGCGGCGGGCCA |
Internal bar code: | TACTTCTAGAACAGGCTGTCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3367 |
LEAP-Seq percent confirming: | 85.9155 |
LEAP-Seq n confirming: | 61 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCTACATCCCTTGGGTGC |
Suggested primer 2: | ACAGTACAAGGACGGCAGTG |