Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.049298 |
Chromosome: | chromosome 16 |
Location: | 2101712 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657650 | FAP35 | Flagellar Associated Protein 35 | 3'UTR |
Cre16.g657700 | (1 of 2) PF13661 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy_4) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAATGCCCATGCAGCGTGCAGCCACCAGCTTCACGATGTGGTACATAG |
Internal bar code: | GGTTGGGCGGCGTAGGGTAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 557 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTGCGATTGCTAGGCACC |
Suggested primer 2: | ACTCGTCTGCTTGGTCCTTG |