| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.049322 |
| Chromosome: | chromosome 10 |
| Location: | 2436967 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435300 | AAP1 | Aspartyl aminopeptidase-like protein; (1 of 1) 3.4.11.21 - Aspartyl aminopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAAGATGCTAGGTGGGGCGGGGTGGGGGGGGGGGGAAGGGCAGGTGGA |
| Internal bar code: | GCAATGCTTGCGATTTGCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 1.96078 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACAGGCATACACTGTCCT |
| Suggested primer 2: | TCGCAATCGATGTAGACCGG |