Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.049331 |
Chromosome: | chromosome 1 |
Location: | 5295058 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g037150 | CLV6 | (1 of 1) PTHR11689//PTHR11689:SF14 - CHLORIDE CHANNEL // CHLORIDE CHANNEL PROTEIN 2; ion channel/ voltage-gated chloride channel | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGACGTCGTGTGGCCGCGTCTCCGTCACACGCGTTGCCGCTGCGCACA |
Internal bar code: | TATGCACATGCGGTTGATGATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1341 |
LEAP-Seq percent confirming: | 85.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACTCCACCACACACACCTC |
Suggested primer 2: | GAGGCAAAGTCCTAGGCGTT |