| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.049331 |
| Chromosome: | chromosome 8 |
| Location: | 1531891 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g365000 | CSE1 | Protein of unknown function; (1 of 3) PF07887 - Calmodulin binding protein-like (Calmodulin_bind) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCGCCAACCAATCCCACCACCACATCTCGCCACTCACGAGCATTCGT |
| Internal bar code: | AGTTTATTACGAGGCGAGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 178 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACACATGCGCCTTTTCAA |
| Suggested primer 2: | ACCTATCCCCCTGACACCTC |