| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049389 |
| Chromosome: | chromosome 3 |
| Location: | 6151482 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g190850 | ECH1 | EnoylCoA hydratase/isomerase; (1 of 1) K13238 - 3,2-trans-enoyl-CoA isomerase, mitochondrial (DCI) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCATCCAAACTGTAGTGTCCAGCGCTGACTATTGCTTTGCTGGTGCT |
| Internal bar code: | CATATTGCCCAGTGGCCAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4227 |
| LEAP-Seq percent confirming: | 83.6735 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTTACGCCGACTACCCG |
| Suggested primer 2: | GTGCCTAAATTCTGGGGGCT |