| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.049414 |
| Chromosome: | chromosome 17 |
| Location: | 5439265 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g738800 | (1 of 1) PTHR15537:SF2 - F-BOX ONLY PROTEIN 7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACACCACACTCCACACCCCCCCACACACACACACACATACACACAC |
| Internal bar code: | CACTATGTTCTCACATAACGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2690 |
| LEAP-Seq percent confirming: | 95.6522 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGGAGTACAGTACGTCG |
| Suggested primer 2: | CATCGACCTGTCCGAGTACG |