| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049566 |
| Chromosome: | chromosome 3 |
| Location: | 2485442 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g159254 | AMT1,AMT1A | (1 of 1) IPR001905//IPR024041//IPR029020 - Ammonium transporter // Ammonium transporter AmtB-like domain // Ammonium/urea transporter; Ammonium Transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGCAGGGTAGCTGGTGCGTGCGTGGCAGGACACCATAGTTACCATTT |
| Internal bar code: | GGTGCTAGGCCTACACTAACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3457 |
| LEAP-Seq percent confirming: | 63.8889 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGAGAAATCGCTCCGTCG |
| Suggested primer 2: | TTCAACACACATGCACGCAG |