| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049596 |
| Chromosome: | chromosome 14 |
| Location: | 624512 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612000 | (1 of 1) K17545 - serine/threonine-protein kinase ULK4 [EC:2.7.11.1] (ULK4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGCCGGCGCGCGGCCGGCGCCCGCCAAGTCGCCACTGGCGCTCTTCCC |
| Internal bar code: | GCGACGGTAGGTATATAGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 940 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGATGTGATGGGCGATACG |
| Suggested primer 2: | GAGGGGCGTGGTGTATGAAA |