Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.049596 |
Chromosome: | chromosome 14 |
Location: | 624512 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g612000 | (1 of 1) K17545 - serine/threonine-protein kinase ULK4 [EC:2.7.11.1] (ULK4) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGCCGGCGCGCGGCCGGCGCCCGCCAAGTCGCCACTGGCGCTCTTCCC |
Internal bar code: | GCGACGGTAGGTATATAGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 940 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGATGTGATGGGCGATACG |
Suggested primer 2: | GAGGGGCGTGGTGTATGAAA |