| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.049601 |
| Chromosome: | chromosome 7 |
| Location: | 1456574 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323750 | HAS2 | (1 of 1) K06133 - 4'-phosphopantetheinyl transferase (LYS5, acpT); Holo-[acyl-carrier-protein] synthase | CDS |
| lncRNA_TCONS_00052104 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGCGAGCAGCACGCGACGTTGTTTCGAGTCGTGGCGATGCTGAGGCC |
| Internal bar code: | CCGGCACACAACTGTTGCGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2439 |
| LEAP-Seq percent confirming: | 15.5556 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAGTGGGGATTCCGTAAC |
| Suggested primer 2: | TGATGAGCATTGGCCACACT |