| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049612 |
| Chromosome: | chromosome 17 |
| Location: | 1747227 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g708650 | HFO27,HFO20 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTGTGCGGGTCTCCTCGTAGATAAGGCCGCTGATACGCTTCACACCG |
| Internal bar code: | GCGATCGCTCCCGAACTCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4498 |
| LEAP-Seq percent confirming: | 95.7447 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTGGGCATGATGGTCAC |
| Suggested primer 2: | CTGTCTTTGGCTCAGGCAGA |