| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.049624 |
| Chromosome: | chromosome 2 |
| Location: | 5245830 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112500 | (1 of 19) K08850 - aurora kinase, other [EC:2.7.11.1] (AURKX) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGGATGTGCGAAACCCTTGTTGGCAATAACGCGGCTTACTCACGCT |
| Internal bar code: | AAGTTGGCTGTTGGGTCAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3468 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGATTGTGTGAGGCCT |
| Suggested primer 2: | CTGTGAGTCTCAAACGGGCT |