| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.049684 |
| Chromosome: | chromosome 6 |
| Location: | 3835412 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278177 | DNL6,LIG6 | (1 of 1) PTHR10459:SF44 - ANKYRIN REPEAT-CONTAINING PROTEIN; DNA ligase 6 | 5'UTR |
| Cre06.g278178 | (1 of 1) PF09495 - Protein of unknown function (DUF2462) (DUF2462) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCACGGAATTGACGGCCGCCTGCGTCTCGGTAACTGCTAGCTTGCACA |
| Internal bar code: | GCGGTTACACGATCTAACACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3698 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCTGGTAGGGCTTGTTT |
| Suggested primer 2: | TGAACTCCGCCAGTGATGAC |