| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.049702 |
| Chromosome: | chromosome 6 |
| Location: | 2004099 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265150 | (1 of 1) K11833 - ubiquitin carboxyl-terminal hydrolase 2/21 [EC:3.4.19.12] (USP2_21) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCATACCACCCGTCGCGGCCGCATTCACCGTCCCCAGCGCCCGCAGCCG |
| Internal bar code: | CACATATAGTACTCAATCTAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2648 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTCGTCTTACTCGCCGGC |
| Suggested primer 2: | GACTGCGGTTGCTCTTGTTG |