| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.049727 |
| Chromosome: | chromosome 16 |
| Location: | 2360253 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g659200 | CYP36,CYP742A1 | (1 of 1) 1.14.13.157 - 1,8-cineole 2-exo-monooxygenase / CYP3A4; Cytochrome P450, CYP4 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGGGACGCGCCGGGTGCAACTGGTGTGCGGAGCGAACTGCTTTGCAA |
| Internal bar code: | TGGGATATTGGTATAACATGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 155 |
| LEAP-Seq percent confirming: | 11.3636 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAGGCATCGGAAGTCAA |
| Suggested primer 2: | GCAGACGAACATCAAGGGGA |