Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.049742 |
Chromosome: | chromosome 14 |
Location: | 602220 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611850 | (1 of 1) K17087 - transmembrane 9 superfamily member 3 (TM9SF3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGCCGCTCAACACTGCGGCCGCACCCACCACACACGCAAACACACAC |
Internal bar code: | TTTCGACTAATCAGTTTCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 576 |
LEAP-Seq percent confirming: | 45.7143 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTTCCTCAGTGTGCGCAT |
Suggested primer 2: | CACCTCTACCCAATGCTGCA |