| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.049775 |
| Chromosome: | chromosome 10 |
| Location: | 5244079 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456300 | NAC2,MBD1 | (1 of 1) IPR003107//IPR013026//IPR019734 - HAT (Half-A-TPR) repeat // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat; PsbD mRNA maturation factor Nac2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGCGCTGCCGCCTCTGGATGCAGTGCGCCGCCCCATGCCCGATGCC |
| Internal bar code: | GCCGCGCTGATCATGATGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2916 |
| LEAP-Seq percent confirming: | 91.8919 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCTCCTCACGCCCTTTT |
| Suggested primer 2: | TCTCCATGCCTCCTCTCACA |