| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049813 |
| Chromosome: | chromosome 6 |
| Location: | 6342561 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293051 | AMT1C,AMT3 | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCTTGATCCTTTTCCGTTGTGCTTTTCTAACACATGTTTCCCTTCGA |
| Internal bar code: | TCGCGGCCCATAGGGACTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 387 |
| LEAP-Seq percent confirming: | 2.77778 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTCCCACTCCCATCCAC |
| Suggested primer 2: | GGGAACAAGGTCAGATGGGG |