Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.049814 |
Chromosome: | chromosome 1 |
Location: | 3722253 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g024251 | (1 of 1) PF00270//PF00271//PF04408 - DEAD/DEAH box helicase (DEAD) // Helicase conserved C-terminal domain (Helicase_C) // Helicase associated domain (HA2) (HA2) | 3'UTR_intron | |
Cre01.g800070 | (1 of 1) PF08482 - ATP-dependent helicase C-terminal (HrpB_C) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGTGTCCGCGTGTTCGCGATCGCAGGCTGCCAGACAGCCTGACGCGCG |
Internal bar code: | AGGGTCATCGCTCGCCTGGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1941 |
LEAP-Seq percent confirming: | 35.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCCTGAAGTCTGTGGCAG |
Suggested primer 2: | CACGCAGGGCTTTAAGGAGA |