| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.049828 |
| Chromosome: | chromosome 13 |
| Location: | 2557718 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g801533 | (1 of 2) 2.4.1.11 - Glycogen(starch) synthase / UDP-glucose--glycogen glucosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGGTGGAGCAGCTTGCTGATGAGTGCTGATCGAGATGTCCTCTGCCC |
| Internal bar code: | CTTAACTTCGCTTAGGGGTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2616 |
| LEAP-Seq percent confirming: | 35.8209 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCGGGATAACTGTACGAG |
| Suggested primer 2: | TGAAAGAGCGCAAGAGAGCA |