Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.049840 |
Chromosome: | chromosome 17 |
Location: | 3210589 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g721450 | NSS4 | (1 of 1) PTHR11819//PTHR11819:SF166 - SODIUM/SOLUTE SYMPORTER // SUBFAMILY NOT NAMED; Sodium:solute symporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCCACCCTGCCTTCACGCCGTTCTTTCTGGGACACTACCGCCTCCG |
Internal bar code: | GGACTCCCGTTCGGGTCATTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1404 |
LEAP-Seq percent confirming: | 80.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACTCAAGTCACTCGCCAC |
Suggested primer 2: | TGTGACAAAGTCGGATGGGG |