| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.049893 |
| Chromosome: | chromosome 12 |
| Location: | 4266454 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518350 | CYG18 | (1 of 2) IPR001054//IPR029016//IPR029787 - Adenylyl cyclase class-3/4/guanylyl cyclase // GAF domain-like // Nucleotide cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGCTGCACGGGGTGCATCATGCGCCCGCTTGCCTGCACCCAGGCCTG |
| Internal bar code: | TCTTATACTACGACACCTAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 30.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTCAACCCTTGTCCCTC |
| Suggested primer 2: | CTGGGGTAACTAGCAGCTCG |