| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.049976 |
| Chromosome: | chromosome 14 |
| Location: | 2762899 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g626400 | CYP33,CYP743C1 | (1 of 3) 1.14.14.1//5.3.99.5 - Unspecific monooxygenase / Xenobiotic monooxygenase // Thromboxane-A synthase / Thromboxane synthetase; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTTGACATGTTGGTTGGCTGGTCGATTGGTTAGTCAGTGGGTCGGTGG |
| Internal bar code: | AGGGCGCTCAAAATAGTATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 47 |
| LEAP-Seq percent confirming: | 18.1818 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCATAACCTCTCCCCTC |
| Suggested primer 2: | AGGAGAACAAGCACCTCAGC |