| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050034 |
| Chromosome: | chromosome 6 |
| Location: | 8769246 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g311000 | FBT2 | (1 of 4) PTHR31585:SF0 - FOLATE-BIOPTERIN TRANSPORTER 1, CHLOROPLASTIC; putative folate/pteridine transporter 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGTCGTGTCGAGTGGCGGTACGGCCCAGCGGGGGCGCATCCACCGCA |
| Internal bar code: | AACAGATAACACCTGATACTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1620 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAATGTGCTGTCGTGCCAA |
| Suggested primer 2: | TGGTGAGGTGGGTATGGGAT |