| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050038 |
| Chromosome: | chromosome 10 |
| Location: | 2628463 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437050 | ATP11 | (1 of 1) K07555 - ATP synthase mitochondrial F1 complex assembly factor 1 (ATPeAF1, ATPAF1, ATP11); Assembly factor 1 for F1 component of mitochondrial ATP synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCCAGCTGGGGCAGGTGGTCAAGTTGGATGAGCTGATCAAGAAGG |
| Internal bar code: | ATAGGACGTCCTGCTCAGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4871 |
| LEAP-Seq percent confirming: | 98.1818 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATGAAGTAAAGAGCGCG |
| Suggested primer 2: | CATGTGCCTTTGATACCGCG |